МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИЙ АНАЛИЗ ВИДОВ РОЗАННОЙ ТЛИ (Macrosiphum rosae L.) ТАШКЕНТСКОЙ ОБЛАСТИ И БОТАНИЧЕСКОГО САДА ИМ. Ф. РУСАНОВА, Г.ТАШКЕНТА (УЗБЕКИСТАН)

THE MOLECULAR GENETIC ANALYSIS OF SPECIES OF ROSEATE APHIDS (Macrosiphum rosae L.) OF THE TASHKENT REGION AND BOTANICAL GARDEN NAMED AFTER F. RUSANOV, TASHKENT (UZBEKISTAN)
Цитировать:
Юлдашева Ш., Анорбаев А.Р. МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИЙ АНАЛИЗ ВИДОВ РОЗАННОЙ ТЛИ (Macrosiphum rosae L.) ТАШКЕНТСКОЙ ОБЛАСТИ И БОТАНИЧЕСКОГО САДА ИМ. Ф. РУСАНОВА, Г.ТАШКЕНТА (УЗБЕКИСТАН) // Universum: химия и биология : электрон. научн. журн. 2023. 9(111). URL: https://7universum.com/ru/nature/archive/item/15878 (дата обращения: 25.02.2024).
Прочитать статью:

 

АННОТАЦИЯ

Данная работа - это морфологический и молекулярно-генетический анализ видов Macrosiphum rosae (Linnaeus, 1758), собранных с роз в различных районах Ташкентской области и Ботанического сада им. Ф.Русанова, г.Ташкента. Идентификацию розанной тли проводили по морфологическим признакам и секвенирование митохондриальных генов. Это важно для отличия данного вида от других видов, систематического анализа и изучения его биологических особенностей. По результатам проведенных исследований, выделено 658 пар оснований нуклеотидов, принадлежащих области COI мДНК образцов видов M. rosae, собранных в Ботаническом саду имени Ф.Н.Русанова, г.Ташкента Юнусаюадского района и Ташкентской области (Кибрайский и Зангиатинский районы). Между нуклеотидами видов M.rosae Q., собранных в Кибрайском районе Ташкентской области, и образцами M.rosae Yu, собранными в Ботаническом саду им. Ф.Русанова город Ташкента, Юнусабадского района выявлено 2 нуклеотидных различия. А также, между образцами M.rosae Q  и образцами  M.rosae Z из Зангиатинского района были обнаружены 2 различия в нуклеотидах. Различий между образцом M.rosae Q и образцом M.rosae полученным из Международной базы данных генов биоинформатики (номер доступа: MN 319988) не обнаружено.

ABSTRACT

This work is a morphological and molecular genetic analysis of Macrosiphum rosae (Linnaeus, 1758) species collected from roses in various districts of the Tashkent region and the Botanical Garden named after. F. Rusanova, Tashkent. Rose aphid was identified by morphological characters and mitochondrial gene sequencing. This is important for distinguishing this species from other species, systematic analysis and study of its biological features. Based on the results of the studies, 658 base pairs of nucleotides belonging to the COI region of mDNA samples of M. rosae species collected in the Botanical Garden named after F.N. Between the nucleotides of the species M.rosae Q., collected in the Kibray district of the Tashkent region, and the samples of M.rosae Yu, collected in the Botanical Garden named after. F.Rusanova city of Tashkent, Yunusabad district revealed 2 nucleotide differences. Also, 2 differences in nucleotides were found between M.rosae Q samples and M.rosae Z samples from the Zangiata region. No differences were found between the M. rosae Q sample and the M. rosae sample obtained from the International Bioinformatics Gene Database (accession number: MN 319988).

 

Ключевые слова: молекулярно-генетический анализ, Macrosiphum rosae, секвенирование митохондриальных генов, праймеры, Международной базы данных генов биоинформатики.

Keywords: molecular genetic analysis, Macrosiphum rosae, mitochondrial gene sequencing, primers, International Bioinformatics Gene Database.

 

Введение. Oсновным вредителем роз являются виды тли, наиболее известные из которых Macrosiphum rosae, которые создают множество проблем и угроз для выращивания розовых растений. Тли рода (Macrosiphum Pass.) повреждают широкий спектр сельскохозяйственных, декоративных [8] и лекарственных растений. Многие виды этого рода являются космополитами – регистрируются всесветно, перемещаясь вместе с посадочным материалом, что приводит к дополнительной интродукции клонов тлей в локальные фауны. В частности, космополитное распространение получил вид розанная тля (Macrosiphum rosae L.), повреждающий розы и шиповники, в том числе при коммерческом выращивании роз в условиях закрытого грунта. Высокая плодовитость и короткий период развития позволяют розанной тле при благоприятных условиях быстро увеличивать численность, что весьма опасно для растений. В результате массового размножения ослабляется рост, замедляется развитие, формируются мелкие и опадающие бутоны. Однако наибольшую опасность M. rosae представляют как переносчики фитопатогенных вирусов, многие из которых, поражая сортовые розы, способны не только снизить выход продукции коммерческого цветоводства, но и привести к потере ценных старых сортов, что в настоящее время происходит повсеместно [12].

В исследовании учёных из Исфахана (Иран) было собрано 135 образцов тли с роз в различных местах парков. Идентификацию этих насекомых проводили по морфологическим признакам и секвенирование митохондриальных генов. По морфологическим признакам эти образцы относились к видам Macrosiphum rosae, Aphis gossypii и Metopolophium dirhodum. Сравнение митохондриальных последовательностей генов розанной тли с существующими последовательностями в банке генов показывает их большое разнообразие, а затем изученные образцы были разделены на четыре группы: Aphis gossipii, Ericaphis scammelli, Macrosiphum rosae и Wahlgreniella nervata. Согласно результатам, Wahlgreniella nervata является новой для фауны Исфаханской тли, а E.scammelli – новой для Иранской тли. Это первое сообщение об этой тле на розе [11].

Широко распространенный и многочисленный вид тлей-вредителей рода Macrosiphum Passerini, 1860 (Hemiptera, Sternorrhyncha: Aphididae) в Беларуси подвергающие опасности розы в основном три вида Macrosiphum rosae (Linnaeus, 1758), Macrosiphum knautiae Holman, 1972 и Macrosiphum silvaticum Meier, 1985. M. rosae  [12].

Возможна по единственному критерию морфологическая дифференциация M. rosae и M. knautiae: отношению длин апикального членика хоботка ко второму членику задней лапки (urs/tarsII). Принято считать, что значение данного морфометрического индекса у тлей является стабильным, поскольку строение хоботка и лапок насекомого непосредственно связано с его способностью закрепляться и питаться на конкретном кормовом растении [9], следовательно, в условиях специализации тлей к конкретным растениям-хозяевам значения этих признаков должны быть максимально жестко генетически детерминированы. В то же время именно адаптивно важные признаки должны иметь наиболее широкую норму реакции, чтобы обеспечить выживание вида в условиях смены растения-хозяина.

Ракаускас (2001, 2003) обсудил специфичность хозяина, жизненные циклы, морфологические особенности и распространение видов тлей на некоторых европейских территориях (Литва, Польша, Чехия, Словакия, Швейцария) и установил синонимию между M. silvaticum и M. knautiae, что впоследствии было подтверждено молекулярными данными. Таким образом, на сегодняшний день в списке тлей Фауна Европы представлены только два действительных вида рода Macrosiphum (M. rosae и M. knautiae) [5; 4].

Синонимы между видами M. rosaeknautiaesilvaticum не принимается в некоторых широко используемых томах по идентификации и информации по тлям. Такая ситуация порождает необходимость тщательного изучения этих видов в других частях ареала его распространения [2;3}.

Молекулярные методы подходят для ответа на основные вопросы о генетическом разнообразии и более систематических отношениях живых организмов, поскольку из-за высокого межвидового и внутривидового разнообразия в популяциях некоторых насекомых, таких как трипсы, белокрылки и тли, морфологический инструмент не эффективен для разделения их, использование молекулярных маркеров является эффективным и достоверным методом [10].

Целью данной исследовательской работы является морфологический и молекулярно-генетический анализ видов Macrosiphum rosae (Linnaeus, 1758), собранных с роз в различных районах Ташкентской области и Ботанического сада им. Ф. Русанова, г.Ташкент. Идентификацию розанной тли проводили по морфологическим признакам и секвенирование митохондриальных генов. Это важно для отличия данного вида от других видов, систематического анализа и изучения его биологических особенностей.

Материал ва методика

Сбор энтомологических материалов: весенне-летние месяцы 2022 года было собрано энтомологические материалы с роз из районов Ташкентской области (Кибрайский и Зангиатинский район) и Ботанического сада им. Ф. Русанова, г. Ташкента. На всех экспериментальных участках случайным образом отбирали пять растений и от каждого растения исследовали три веточки для подсчета зараженности тлей. Тлю стряхивали с побегов, бутонов, цветков и иногда с нижней стороны листьев растений розы, на белую бумагу и подсчитывали, чтобы определить вредоносность тли в разных местах по методике Insha Yousuf [8]. Самец играет важную роль для исследования. Количество тлей в образцах, взятых с роз в ботаническом саду им. Ф.Русанова Юнусабадского района города Ташкента, самки и в среднем 72 шт, самец 2 шт, количество тлей в образцах роз, взятых из Кибрайского района, составляет в среднем 48 самок и самец 1 шт, в образцах количество тлей взятых с роз, из Зангиатинского района, в среднем 68 шт, самца 2 шт. Сбор тлец проводили по методике К.К.Фасулати (1961) и Insha Yousuf (2020).

Морфологический анализ: цвет от зеленого до тёмно розового и красновато-коричневого, усики и ноги бледные, пара маленьких направленных назад трубочки на брюшке черные. http://www.aphidsonworldsplants.info/ Blackman & Eastop [1]. Текущий таксономический статус и номенклатура всех видов тлей соответствуют Favret (2020).  В оснавном вредит розам, иногда встречается на клубнике. На верхнее стороне усиков имеются 3 иногда 4 волосинки [19].

Выделение ДНК: Для молекулярно-генетических исследований были собраны образцы Macrosiphum passerini, 1860 видов Macrosiphum rosae, в Кибрайском и Зангиатинском районах Ташкентской области и Ботаническом саду им. Ф.Русанова, г. Ташкент. для выделения ДНК из выбранных образцов использовался набор реагентов GeneJET GENOMIC DNK.

Определение ДНК проводили в несколько этапов: 1. 20 мг материала M. rosae измельчают в жидком азоте до гомогенности. 2. Материал помещают в эпиндорф на 1,5 мл и заливают 180 мкл раствора Digestion Solution, перемешивается на вортексе. 3. Добавьляется 20 мкл раствора протеиназы К и хорошо перемешайтся вортексом или пипеткой. 4. Образец выдерживают при температуре 56°С до полного разделения ткани и отсутствия частиц (до 6-8 часов). 5. Добавляется 20 мкл раствора RNase A Solution, перемешиваем на вортексе и оставляем при комнатной температуре на 10 минут. 6. Добавляем 200 мкл раствора Lysis Solution, перемешивается на вортексе и оставляем при комнатной температуре на 10 минут. 7. Добавляем 400 мкл 50 % этанола перемешиваем вортексе. 8. Приготовленный раствор переносим на колонку для очистки ДНК GeneJET Genomic и центрифугируем при 6000 х g в течение 1 минуты. 9. Поместим колонку для очистки геномной ДНК GeneJET в новую пробирку объемом 2 мл. 10. Добавляем 500 мкл буфера I в пробирку для очистки и центрифугируйте в течение 1 минуты при 8000 х g. 11. Помешяем колонку для очистки геномной ДНК GeneJET в новую пробирку объемом 2 мл. 12. Добавьте 500 мкл буфера II в пробирку для очистки и центрифугируйте на максимальной скорости (≥12000 g) в течение 3 минут. 13. Перенесем колонку для очистки геномной ДНК GeneJET в чистый эпиндорф объемом 1,5 мл. 14.  Добавляем 200 мкл Elution буфера в центр колбы колонки для очистки. 15. Эпиндорф выдерживаем при комнатной температуре в течение 2 минут и центрифугируем при 8000 g в течение 1 минуты. 16. Утилизируем колонку для очистки и храним выделенную ДНК при температуре -20°C.

Амплификация методом ПЦР. С целью изучения нуклеотидной последовательности COI-района хромосомы геномную ДНК выделенных для амплификации насекомых амплифицировали с использованием реактивов фирмы «Силекс» - вода стерилизованная, 10х буфер для ПЦР, раствор dNTP, Taq-полимераза и следующие праймеры, используемые в молекулярной таксономии (1-таблица).

Таблица 1.

Праймеры используемые в молекулярной таксономии

Название параймера

(правильный праймер)

 Название параймера

(правильный праймер)

1

FWD_SEQ: ATTCAACCAATCATAAAGATATTGG

REV_SEQ: TAAACTTCTGGATGTCCAAAAAATCA

2

FWD_SEQ:

TGTAAAACGACGGCCAGTAATCATAARGATATYG

REV_SEQ: TAAACTTCTGGATGTCCAAAAAATCA

 

Полимеразную цепную реакцию (ПЦР) проводили с помощью программируемого автоамплификатора(Touchgene Gradient, UK). Master-mix был приготовлен из следующих реагентов по инструкции компании 2-таблица.

Таблица 2.

 Список реактивов для приготовление Мастер-микс

Вода (стер.)

13.8 мкл

буфер 10х ПЗР

2 мкл

dNTP

0.6 мкл

С каждого праймера

1.5+1.5 мкл

Taq-полимераза

0.6 мкл

Итог:

20 мкл

 

ПЦР проводили по следующей схеме: 1 - этап - Денатурация ДНК при 95°С в течение 3 минут, 2 - этап - Денатурация ДНК при 93°C в течение 20 секунд, 3 - этап - Связывание праймеров с ДНК при 55°С в течение 30 секунд, 4 - этап - Элонгация при 72°С в течение 2 минут, 5 - этап - элонгация цепи при 72°С в течение 10 минут. Со второго по четвертый этап процесс повторялся до 35 раз в циклической форме (3-таблица).

Таблица 3.

Температура и время ПЦР

Реакция

(Программа)

Этап

Температура  (°С), цикл

время

 

 

 

I

 

 

Исходный денатурация

95

3 минут

Денатурация

93

 

45 цикл

20 секунд

Завершение

48

30 секунд

Элонгация

72

2 минут

Завершить цепочку

72

10 минут

 

Секвенирования – Определение нуклеотидной последовательности ДНК – при секвенирования очищенных из геля образы ПЦР, измеряли концентрации ДНК из очищенной гели и секвенсировали с использованием праймеров для ПЦР.

Для исправления ошибок полученных данных из последовательности, результаты последовательности были преобразованы в FASTA-формат с помощью правильного и обратного праймеров. Затем для объединения результатов двух хроматографий было сделано с помощью программы «Clustal X версии 1.81» [17]. При помоши программы «Gendoc version 2.5.000» [McCarthy; URL:www.cris.com.] были удалены ненужные нуклеотыды. Для конвертации в Nexus-формат использовалась программа "ForCon version 1.0 for Windows" [18].

Филогенетические отношения: для построения филогенетического дерева были использованы последовательности нуклеотидов, полученные в результате секвенирования, и последовательности ДНК, полученные из базы данных Международного центра биотехнологической информации (https://www.ncbi.nlm.nih.gov), и эти последовательности были отредактированы с использованием программного обеспечения Genius Prime. Консенсусные последовательности рассчитывали с использованием расчетного программного обеспечения Mega X. Полученные первичные данные из этой программы и дополнительные последовательности из базы данных GenBank были выровнены с использованием стандартных настроек онлайн-программного обеспечения MAFFT v.7 и сравнивались с программой Clustal Omega 1.2.2 и отредактированы с помощью Genius Prime.. Нуклеотидные последовательности, принадлежащие полученному ITS-участку, определяли с помощью IQ-TREE версии 1.6.12 путем сверхбыстрой начальной загрузки с максимальным филогенетическим деревом из 1000 итераций, а анализы выполняли в CIPRES Science Gateway V 3.3.

Анализ и результаты исследования

Молекулярно-генетический анализ. Для молекулярно-генетических исследований ДНК была извлечена из ног и усов самца вида M. rosae. Результаты проведенных исследований показывают, что выделено 658 пар оснований нуклеотидов, принадлежащих области COI мДНК образцов видов M. rosae, собранных в Ботаническом саду имени Ф.Н.Русанова, г.Ташкента Юнусабадского района и Ташкентской области (Кибрайский и Зангиатинский районы). Скорректированный вид M.rosae с использованием программного обеспечения для биоинформатики изучали путем сравнения нуклеотидов между 3 образцами, и нуклеотиды сравнивали с видом M.rosae (номер доступа:МN319988) из Международной базы данных генов биоинформатики (рисунок 1).

 

Примечание:M.rosae Q (Кибрай), M. Rosae Yu. (Юнусобод), M. Rosae Z. (Зангиота)

Рисунок 1. Сравнение нуклеотидной последовательности из 3 образцов видов M.rosae и полученной последовательности COI мРНК вида  M.rosae из Международной базы данных генов биоинформатики (номер доступа: MN 319988)

 

Как видно из приведенного рисунка, между нуклеотидами видов M.rosae Q., собранных в Кибрайском районе Ташкентской области, и образцами M.rosae Yu, собранными в Ботаническом саду им. Ф.Русанова город Ташкент, Юнусабадского района выявлено 2 нуклеотидных различия. Эти различия заключаются обмен нуклеотидов в 309-м и 341-м нуклеотидах, то есть в 309-м нуклеотиде А-аденине в образце M.rosae Q, G-гуанине в образце M.rosae Yu и в 341 нуклеотиде С-цетозине в образце M.rosae Q и А-аденин в образце M.rosae Yu.

Между образцами M.rosae Q  и образцами  M.rosae Z из Зангиатинского района были обнаружены 2 различия в нуклеотидах, и эти различия были отмечены как T-темин в образце M.rosae Q и обмен нуклеотидов A-аденина в M.rosae Z в нуклеотидах 197 и 230.

Различий между образцом M.rosae Q и образцом M.rosae полученным из Международной базы данных генов биоинформатики (номер доступа: MN 319988) не обнаружено.

Филогенетические отношения. По результатам исследования нуклеотидных последовательностей, принадлежащих полученной COI мДНК, и анализа нуклеотидных последовательностей, полученных из базы данных GenBank, установлено, что виды, относящиеся к роду Macrosiphum Passerini, 1860, были объединены в 3 монофилетические группы (рисунок 2).

Рисунок 2. Филогенетическое древо видов, отнесенных к роду Macrosiphum Passerini (1860 г.), построено на основе алгоритма максимального правдоподобия: (1000 бутстрепных повторов). Значения загрузки бутстрапа показаны в соответствующем узле

 

Первая монофилетическая группа, вида M.rosae, принадлежащие к роду Macrosiphum, давала значение бутстрепной нагрузки 18/95%.

Вторая монофилетическая группа, вида M.funestum, принадлежащие к тому же роду, давали значение бутстрепной загрузки 98%.

Третья монофилетическая группа, виды M.euphorbiae и M.valerianae, принадлежащие к этому роду, характеризовались тем, что давали значение бутстрепной нагрузки 60/100%

Выводы. Результаты проведенных исследований показывают, что выделено 658 пар оснований нуклеотидов, принадлежащих области COI мДНК образцов видов M. rosae, собранных в Ботаническом саду имени Ф.Н.Русанова, г.Ташкента Юнусабадского района и Ташкентской области (Кибрайский и Зангиатинский районы). Между нуклеотидами видов M.rosae Q., собранных в Кибрайском районе Ташкентской области, и образцами M.rosae Yu, собранными в Ботаническом саду им. Ф.Русанова город Ташкент, Юнусабадского района выявлено 2 нуклеотидных различия. А также, между образцами M.rosae Q  и образцами  M.rosae Z из Зангиатинского района были обнаружены 2 различия в нуклеотидах. Различий между образцом M.rosae Q и образцом M.rosae полученным из Международной базы данных генов биоинформатики (номер доступа: MN 319988) не обнаружено. В результате исследований установлено, что виды, относящиеся к роду Macrosiphum Passerini, 1860, объединены в 3 монофилетические группы.

 

Список литературы:

  1. Blackman R.L., Eastop V.F. Aphids on the World’s Plants // An Online Identification and Information Guide. 2020.  Available from: URL: http://www.aphidsonworldsplants.info (accessed 2 May 2020) (дата обращения: 14.08.2023).
  2. Blackman R.L., Eastop V.F.  Aphids on the World’s Herbaceous Plants and Shrubs. Chichester: John Wiley and Sons, Ltd. 2006.
  3. Holman J. Description of Macrosiphum knautiae sp. n., with notes on the taxonomy of the M. rosae group (Homoptera, Aphididae) // Acta Entomologica Bohemoslovaca. – 1972. – Vol.  69. – Pp. 175–85.
  4. Lampel G., Meier W. Hemiptera: Sternorrhyncha – Aphidina // Aphididae. Fauna Helvetica. – 2007. – Vol. 16. –  P. 523.
  5. Nieto Nafría, J.M., Andreev A.V., Binazzi A., Mier Durante M.P., Pérez Hidalgo N.J., Rakauskas R., Stekolshchikov A.V. Superfamily Aphidoidea // Fauna Europaea Service. 2004. URL: http://www.faunaeur. org. (дата обращения: 12.08.2023).
  6. Rakauskas R. On the identity of Macrosiphum silvaticum Meier 1985 // Aphids and other homopterous insects (Warszawa). – 2001. – Vol. 8. – Pp. 35–42.
  7. Rakauskas R. Macrosiphum on Knautia in Europe: biology, morphology and systematics, including new synonymy (Hemiptera, Aphididae) // Deutsche entomologische Zeitschrift. –Vol. 50 (2). – Pp. 181–190.
  8. Yousuf I., Buhroo A. A. Seasonal incidence and bionomics of rose aphid, Macrosiphum rosae (Linnaeus, 1758), (Hemiptera: Aphididae) in Kashmir, India //Acta agriculturae Slovenica. – 2020. – Vol. 115. – № 2. – Pp. 283–295.
  9. Shaposhnikov G. C h. Aphids and the step toward the universal species concept // Evolutionary Theory. – 1984. –  Vol. 7. – Pp. 1–39.
  10. Jalalizand A. R. et al. Morphological and molecular identification aphids of Rosae //Apcbee Procedia. – 2012. – Vol. 4. – Pp. 12-15.
  11. Jalalizand A. R. et al. Determining morphological traits and genetic diversity of rose aphids using RAPD and RFLP-PCR molecular markers // International Conference on Applied Life Sciences. – IntechOpen, 2012.
  12. Сауткин, Ф.В., Буга С.В. 2007. Дендрофильные и дендрохербофильные тли – вредители цветочно-декоративных растений, интродуцированных в Беларусь // Теоретические и прикладные аспекты интродукции растений как перспективного направления развития науки и народного хозяйства : материалы Международной научной конференции (Минск, 12–15. 06. 2007).
  13. Turčinavičienė J., Rakauskas R.  Macrosiphum on Knautia in central Europe – molecular data support the synonymy of M. silvaticum and M. knautiae (Hemiptera Aphididae) // Redia – Vol. XCII. – 2009. – Pp.105–109.
  14. Сауткин Ф. В., Буга С. В. Дендрофильные и дендрогербобионтные тли – вредители цветочно-декоративных растений, интродуцированных в Беларусь // Теоретические и прикладные аспекты интродукции растений как перспективного направления развития науки и народного хозяйства: материалы Междунар. науч. конф., посвящ. 75-летию со дня образования Центрального ботанического сада НАН Беларуси (Минск, 12–15 июля 2007 г.). –  В 2 т. –  Минск, 2007. –  Т. 2. –  С. 230–232.
  15. Фасулати К.К. Полевое изучение наземных безпозвоночных. –  М.: Изд-во «Высшая школа», 1961. –  С. 178-179.
  16. Favret C. Aphid Species File. Version 5.0/5.0. – 2020. – Available from: http://Aphid.SpeciesFile.org (accessed 2 May 2020) (дата обращения: 10.08.2023).
  17. Swofford D.L. PAUP*(version 4.0) // Phylogenetic analysis using parsimony (* and other method). –1998. – Sunderland MA, (beta version).
  18. Faust K., Raes J.. Microbial interactions: from networks to models // Nat Rev Microbiol. – Vol. 10. – Pp. 538-550
  19. Великань В.С. Определитель вредных и полезных насекомых и клещей плодовых и ягодных культур СССР/ Колос. –Ленинград, 1984. – 73 c.
  20. [Электронный ресурс] – Режим доступа: www.cris.com. (дата обращения: 08.08.2023).
  21. [Электронный ресурс] – Режим доступа: https://www.ncbi.nlm.nih.gov . (дата обращения: 09.08.2023).
  22. [Электронный ресурс] – Режим доступа: http://www.aphidsonworldsplants.info/. (дата обращения: 06.08.2023).
Информация об авторах

докторант, соискатель (PhD), Ташкентский государственный аграрный университет, Республика Узбекистан, г. Ташкент

Postdoctoral Student, Degree-seeking student (PhD), Tashkent State Agrarian University, Republic of Uzbekistan, Tashkent

д-р с.-х. наук, проф., Ташкентский государственный аграрный университет, Республика Узбекистан, г. Ташкент

Doctor of Agricultural Sciences, Professor: Tashkent State Agrarian University, Republic of Uzbekistan, Tashkent

Журнал зарегистрирован Федеральной службой по надзору в сфере связи, информационных технологий и массовых коммуникаций (Роскомнадзор), регистрационный номер ЭЛ №ФС77-55878 от 17.06.2013
Учредитель журнала - ООО «МЦНО»
Главный редактор - Ларионов Максим Викторович.
Top