INFLUENCE OF GLYCYRIZIC ACID COMPLEXES ON WHEAT RESISTANCE TO FUNGAL DISEASES

ВЛИЯНИЕ КОМПЛЕКСОВ ГЛИЦИРИНОВОЙ КИСЛОТЫ НА УСТОЙЧИВОСТЬ ПШЕНИЦЫ К ГРИБНЫМ ЗАБОЛЕВАНИЯМ
Yunusov O. Hojiboboeva S.
Цитировать:
Yunusov O., Hojiboboeva S. INFLUENCE OF GLYCYRIZIC ACID COMPLEXES ON WHEAT RESISTANCE TO FUNGAL DISEASES // Universum: химия и биология : электрон. научн. журн. 2023. 6(108). URL: https://7universum.com/ru/nature/archive/item/15453 (дата обращения: 11.07.2026).
Прочитать статью:
DOI - 10.32743/UniChem.2023.108.6.15453

 

ABSTRACT

The aim of this study was to analyse the impact of the plant-derived elicitor, cobalt glycyrrhizic acid, on DNA polymorphism by molecular markers. The experiment confirmed the protective effect of glycyrrhizic acid against contamination caused by fungi developed within in vitro cultures. Our results indicated the increase of miR168 loci amplification in tested samples with increasing concentration of applied elicitor, compared with the control. Thus we confirmed the role of miR168 as a functional biomarker sensitive to exogenously applied elicitors. Different concentrations of plant-derived elicitor affected the variability of genomic DNA. Specifically, the 1% and 0.1% concentrations of cobalt glycyrrhizic acid may have an impact on molecular level.In RAPD analysis, the lowest number of fragments was recorded in the control samples of leaves or roots and significant polymorphism was observed in the rest of samples. In comparison to RAPD profiles of individual samples, the ISSR fragments were almost monomorphic.

АННОТАЦИЯ

Целью данного исследования был анализ влияния элиситора растительного происхождения, кобальт-глицирризиновой кислоты, на полиморфизм ДНК с помощью молекулярных маркеров. Эксперимент подтвердил защитный эффект глицирризиновой кислоты от контаминации, вызванной грибками, развившимися в культурах in vitro. Наши результаты показали увеличение амплификации локусов miR168 в тестируемых образцах с увеличением концентрации применяемого элиситора по сравнению с контролем. Таким образом, мы подтвердили роль miR168 как функционального биомаркера, чувствительного к экзогенно применяемым элиситорам. Различные концентрации элиситора растительного происхождения влияли на изменчивость геномной ДНК. В частности, концентрации глицирризиновой кислоты кобальта 1% и 0,1% могут оказывать влияние на молекулярном уровне. При RAPD-анализе наименьшее количество фрагментов было зарегистрировано в контрольных образцах листьев или корней, а в остальных образцах наблюдался значительный полиморфизм. . По сравнению с RAPD-профилями отдельных образцов фрагменты ISSR были почти мономорфными.

 

Keywords: cobalt diglycyrrhizinate, elicitor, microRNAs, RAPD, ISSR

Ключевые слова: диглицирризинат кобальта, элиситор, микроРНК, RAPD, ISSR

 

Introduction

Wheat is considered to be the main grain industrial culture in the world. At the same time winter wheat has several phyto-pathogens, the development of which considerably limits the potential opportunities of modern sorts of intensive types. More harmful ones are yellow and brown rust (Puccinia spp.) and Erysiphe graminis that causes a fungal infection known as powdery mildew. Harm of rusts and Erysiphe graminis can reach 15 – 25 %. On the background of intensive technologies of cultivation of winter wheat, their harmfulness strengthens and the lost of harvest can be increased to 5 – 10 % [1]. The rust decreases endurance of plants to the unfavourable stressful factors, brings to premature of die off the leaves and stopping photosynthesis, decreasing of sustainability of adolescent sowings and lots of harvest [2]. Erysiphe graminis is enlarged on widely. Leaves of sick plants are covered with white incursion of conidial soporiferous fungus, get yellow, and in hot affection, die. On powdery coating can appear black dotted formations – cleistothecium of pathogens (ascigerous stage) [3]. The rust in the world is widely introduced on wild grasses, some of them are considered to be natural reservatum of pathogens for agricultural plants [4].

Chemical preparations are used for the control of rust and Erysiphe graminis. Though, having effective fungicidal properties, they can have unfavourable influence on the growth and development of cultural plants, especially on winter wheat. Chemical control of pathogens is a source of serious pollution of agrarian-ecological system, water and food products. More constant, long and safe protective effect brings biologically active substances. They optimize the functional condition of plants, at the same time initiate high sustainability level to the pathogens and other unfavourable environmental factors [5].

The main factor which manages implementation of morphogenetic potential of organism are phytohormones [6]. In certain correlations and concentrations they are responsible for expression of specific genes, and consequently for implementation of genetic programs of plants. It is obvious, that with the laps of time the list of regulators and phytohormones is increased. This widens our opinions about how the hormonal system regulates ontogenesis of plants and how it participates in response of plants to different outer reactions.

Many plant parasites, such as fungous, as well as bacterial origins use different phytohormones, which actively synthesize for “chemical attack” on host plant [7]. In the process of evolution, the pathogens produced adjustment complexes in order to extract necessary substances from plant tissue. Although, introduction of infectious structures disturbs the integrity of plant organism. Obligatory parasitism in its appearance is analogical to abiotic stress which does not kill the plant, but mobilize all system to high activeness for reparation. Dyakov [8] points out the activation of stressed metabolite synthesis during the first stages on pathogen introduction. The plant opposes to the introduction of pathogens regardless of virulence but when it is perceptive to pathogens, response reactions on contamination proceeds inertly and parasite manages to form infectious hyphae and give spawn.

Introduction of pathogens arouses the sustainable plant cascade of protective reaction which results localization of infectious hearth and appearance of system acquired sustainability in plant organism. Its formation connects with production of signal molecules in infected tissues and their translocation to uninfected parts of plant where they induce protective reactions, which promotes the decrease of sustainability to secondary infections [9].

One of the signal inductors of an introduction of pathogens is considered to be arachidonic acid which belongs to the content of cellular hypha of phytopathogenic fungus [10].

There are several secondary metabolites that protect plants from unfavourable organisms. One of these bonds exists in healthy tissues, others appear in the response to the infection. Reasonable parts of protective belong to phenol bonds [11]. Oxide cinnamic acids as n-oxide cinnamic (n-coumaric acid), caffeic, ferulic or sinapic exist in the plants in free as well as bonded type. They have influence on the process of growth, and their productivity – oxide cinnamic acids – initial components in biosynthesis of lignin [12]. Lignifications of cellular side creates mechanical border to penetration of infections [9-12].

The salts of glycyrrhizin acid play the important role during the period of starting stages of infectious process. It was found the accumulation of salts of some compounds of glycyrrhizin acid in the sites of interrelations of wheat epidermis and Erysiphe graminis [13].

One of the compounds of glycyrrhizin acid is diglycyrrhizinate cobalt. The compounds, which activate chemical defence of plants are referred to as elicitors. They represent a type of signalling molecules triggering the formation of secondary metabolites by inducing plant defence mechanism [14]. Commonly tested chemical elicitors are salicylic acid, methyl salicylate, benzoic acid and so forth which affect production of phenolic compounds and activation of various defence-related enzymes in plants [14].  Biotic elicitors include polysaccharides, proteins, glycoproteins derived from fungi, bacteria and plants [13-14]. Their introduction into agriculture practice could minimize the scope of chemical control, thus contributing to the development of sustainable agriculture [15].

Physiologically active substances as phytohormones represent a promising way of plant protection against the rust and Erysiphe [13]. They are responsible for expression of specific genes, which regulate plants ontogenesis and consequently for implementation of plant response to pathogen as well as of different abiotic factors.

Molecular markers based on DNA polymorphism represent a powerful and effective tool of genome mapping and variability recording due to various exogenous factors applied. In this study, randomly amplified DNA fragments (RAPD), amplified fragments between simple sequence repeats (ISSR) and amplified fragments of regulatory molecules microRNA (miRNA) were used as DNA-based molecular markers. 

Material and methods

Plant material

The grains of Triticum aestivum variety Dustlik, originated from Uzbekistan were used in the study. Grains were surfaced sterilized in 0.1% solution of mercuric chloride during 5 minutes, followed by sterilization in 70% ethanol for 5 minutes and rinsed in sterile distilled water three times. Consequently, grains were immersed in the solution of cobalt diglycyrrhizinate of various concentrations (1%; 0.1%; 0.01% and 0.001%) during 2 hours. Different concentrations of the agent were prepared using the sterile distilled water. The procedure of seeds material preparation and fungicide stock solutions was carried out in flow laminar cabinet.

In the study was applied the plant-derived elicitor, cobalt glycyrrhizic acid [13]. 

In vitro culture experiment

Under aseptic conditions grains were placed on Murashige &Skoog [16] plant growth medium (1962), five grains per tissue culture vessel. In total twenty grains per tested variant. The cultivation has been carried out under controlled conditions (photoperiod 16/8 hours day/night; 23°C/20°C and light intensity 50 µmol×m-2 ×s-1). The germination of grains started after two days of cultivation.

Genomic DNA isolation

Five-day old seedlings (first rinsed with water) were used to isolate the genomic DNA from roots and leaves by the Saghai-Maroof et al. (1984) methods. The pool of tissues from ten plants was used for DNA isolation. The quality and concentration of isolated DNA was checked by nanophotometer P360 (Implen). For the following experiments was DNA diluted to concentration of 20 ng×µl-1 (RAPD), 50 ng×µl-1  (ISSR) and 70 ng×µl-1  (miRNA).

Molecular markers assay

Diluted genomic DNA from roots and leaves of wheat seedlings of control and tested variants was subjected to PCR amplification using RAPD (Random Amplified Polymorfic DNA), ISSR (Inter-Simple Sequence Repeats) and miRNA (micro RNA) markers. Individual reactions were repeated twice.

PCR-RAPD amplification was performed in a 20-µl of total volume reaction mixture containing 20 ng of genomic DNA, 1 × PCR buffer containing 0.8 M Tris-HCl, 0.2 M (NH4)2SO4 and, 0.2% w/v Tween-20, 2.5 mM MgCl2 1U of FIREPol® DNA polymerase, 0.2 mM dNTP mix (Invitrogen) and 0.4 µM of OPB05 primer (5´TGC GCC CTT C 3´). The RAPD amplification protocol consisted of initial denaturation at 940 C for 2 min; 45 cycles of denaturation at 940C for 1 min, annealing at 360 C for 1 min, extension at 720C for 2 min and final extension for 7 min at 720 C. The PCR-RAPD products were separated on 1.5% agarose gel together with 1 Kb DNA ladder (Bio-Rad) running in 1×TBE buffer at a constant power 90 V for 1 hour. PCR-ISSR amplification was performed in a 20-µl of total volume reaction mixture containing 50 ng of genomic DNA, 1 × PCR buffer containing 0.8 M Tris-HCl, 0.2 M (NH4)2SO4 and, 0.2% w/v Tween-20, 2.5 mM MgCl2 and 1U of FIREPol® DNA polymerase, 0.2 mM dNTP mix (Invitrogen) and 0.4 µM of ISSR-UBC 810 primer (GA)8T. The ISSR amplification protocol consisted of initial denaturation at 940 C for 2 min; 35 cycles of denaturation at 940C for 1 min, annealing at 470 C for 1 min, extension at 720C for 2 min and final extension for 7 min at 720 C. The PCR-ISSR products were separated on 2% agarose gel together with 1 Kb DNA ladder (Bio-Rad)  running in 1×TBE buffer at a constant power 90 V for 1 hour. PCR-miRNA amplification was performed in a 20-µl of total volume reaction mixture containing 70 ng of genomic DNA, 1× DreamTaq buffer (Thermo Scientific™), containing KCl, (NH4)2SO4 and 20 mM MgCl2, 1U of  Dream Taq DNA polymerase (Thermo Scientific™), 0.8 mM dNTP mix (Invitrogen)  and 0.4 µM of lus-miR168 (5´CACGCATCGCTTGGTGCAGGT3´) and lus-miR395 (5´CACGCACTGAAGTGTTT GGGG3´) forward primers  and universal reverse primer (5´CCAGTGCAGGGTCCGAGG TA3´). The PCR amplification programme used the ´touchdown´ method as follows: initial denaturation at 940 C for 5 min; 5 cycles of denaturation at 940C for 30 s, annealing at 640 C for 45 s (with  1°C decrease in annealing temperature per cycle) and 60 s at 720C; 30 cycles of 30 s at 94°C, 45 s at 60°C and 60 s at 72°C and final extension for 10 min at 720 C. The PCR-miRNA products were separated were firstly checked on 3% agarose gel for the presence of amplified products and consequently loaded on 10% Novex®TBE-Urea gels together with 10 bp DNA ladder (Invitrogen) running in 1×TBE buffer at a constant power 180 V for 1.45 hour.

Data analysis

The PAGE gels were stained with the GelStar™ Nucleic Acid Gel Stain (supplied as a 10,000× concentrated stock solution) for 20 minutes. Both agarose and polyacrylamide gels were visualized in the G-Box Syngene electrophoresis documentation system. For the recording of individual tracks fragments profiles were gels analyzed by the GeneTools software (Syngene). Each fragment is characterized  by quantity and volume of its profile in  pixels. Profiles are recorded on the basis of set threshold value in which the analysis is carried out.

Results and discussion

After treatment of wheat grains in different concentrations of tested solutions (1%; 0.1%;  0.01% and 0.001%), cobalt glycyrrhizic acid during two hours followed by their placement on cultivation medium, the germination rate (after two days) as well as the protective role of glycyrrhizic acid on the contamination was tested under in vitro conditions (Fig. 1 LC). The experiment confirmed the protective effect of glycyrrhizic acid against contamination caused by fungi developed within in vitro cultures. This statement is supported by information concerned to the antifungal and antibacterial activity of liquorice extract. E. g. former in vitro studies proved its inhibitory activity on cultures of Staphylococcus aureus and Streptococcus pyrogenes [17].

 

Figure 1. LC. Germination rate and contamination level of winter wheat grains caused by fungi affected by cobalt diglycyrrhizinate within in vitro conditions

 

In RAPD analysis, random decamer of OPB set, was used to screen the variability of wheat genome in regard of the influence of the tested elicitor. In total, 87 DNA fragments were amplified, whereas the lowest number of fragments was recorded in the control samples of leaves and roots (5 or 7 respectively). Significant polymorphism was observed in the rest of samples. Even each of the tested concentrations was reflected in a unique profile of RAPD-DNA fragments, reaching the number from 8 up to 11 fragments per sample (Figure 2 LC). This potential of RAPD markers to characterize individuals by unique DNA fingerprinting profile has been proved in liquorice itself [18]. Sixteen primers gave species specific reproducible unique amplicons, which clearly distinguished genuine as well as adulterant samples having similar morphology.

 

Figure 2. LC. Polymorphism analysis of 5-days old wheat seedlings treated with cobalt glycyrrhizic acid-based elicitor by RAPD marker: M - marker, C - control plants. The similarity of the DNA profiles of the control samples is highlighted

 

Presence of a RAPD band corresponds to a dominant allele against absence of bands that corresponds to a recessive allele. Thus, heterozygous and homozygous dominant individuals cannot be differentiated with RAPD markers [19]. In comparison with the studies focused on molecular characterization of wheat using RAPD markers, is the total number of DNA fragments per one primer quite high. In he work [19] recorded 54 amplicons by six random primers in 17 wheat accessions. The number of amplified fragments revealed by each primer ranged from 1 to 4. The highest polymorphism recorded reached 27.5%. The amplified product size ranged from 200 bp to 2000 bp depending on the type of primer. Higher affectivity in RAPD amplification observed 19]. A total 142 fragments were obtained by 17 primers from 16 wheat genotypes. The number of DNA fragments for each primer varied from 3 to 14. The polymorphism level varied from 33.3 up to 100%. Molecular sizes of amplified fragments ranged from 300 bp to 2800 bp. 190 DNA fragments generated by 25 primers in 10 wheat genotypes recorded [18-19]. All primers used yielded between 3 and 10 amplification products that ranged in size from 170 bp to 2600 bp. The polymorphism level reached almost 45%.

In comparison to RAPD profiles of individual samples, the ISSR fragments were almost monomorphic (Figure 3 LC). DNA polymorphism from leaf tissues did not reflect any variability whereas in root tissues it was observed the difference in ISSR fragments profile. The profile of control sample and the sample affected by the lowest (0.001%) concentration of elicitor was unique in contrast to higher concentrations which indicates its influence on polymorphism of microsatellites DNA. The same type of ISSR marker was used in the study of Talieva [20], where in total 10 DNA fragments were amplified in 33 analysed accessions of wheat. In general, the number of DNA fragments amplified by 22 RAPD primers in 33 wheat accessions was higher in comparison to bands obtained by 20 ISSR primers which was in accordance to our observation. Bej S., Basak J. [21] successfully applied both types of markers (RAPD and ISSR) associated with drought tolerant loci of wheat genome and also in defining polymorphism between susceptible and drought tolerant wheat cultivars.

 

Figure 3. LC. Polymorphism analysis of 5-days old wheat seedlings treated with cobalt glycyrrhizic acid-based elicitor by ISSR marker: M - marker, C - control plants

 

Short molecules of microRNA (20–24 nt) play critical roles in development and nutrient homeostasis as well as are involved in plant immunity. They are part of the regulatory mechanism of gene expression of plants under biotic and abiotic stress. They are derived from single-stranded RNA precursors that form stem-loop structures. They are able to bind to the target mRNAs, resulting in a translation delay or mRNA degradation. Due to high conservation of microRNA sequences, high reproducibility, polymorphism, efficiency and good transferability across different species, are miRNA markers considered as reliable having putative functionality [22].

For the testing the effect of cobalt diglycyrrhizinate-derived elicitor on winter wheat seedlings, a type of conserved miRNA families has been chosen. The miR168 family is considered as the biomarker of plant stress response [37]. Markedly increased accumulation of miR168 in virus-infected plants observed Várallyay et al. (2010) indicating its importance in virus-infection process. One of the target sequences of miR168 family are sequences of cytochrome P450 which is involved in a wide range of biosynthetic reactions. The regulation role of miR168 in connection to AGO 1 protein is crucial for plant development [22].

In the process if biogenesis are miRNAs molecules transcribed as long RNA transcripts, called primary miRNAs (pri-miRNAs). These pri-miRNAs are cleaved into precursor miRNA (pre-miRNA) with stem-loop structure [22]. In plants, the size of stem-loop structures ranges from less than 100 to over 900 nt. Primers based on miRNA-sequences combining with different places of the same stem-loop structure can produce fragments which allow to distinguish individual genotypes.  It is also likely that the primers amplify regions between neighbouring miRNAs, resulting in additional variation.

Our results indicate the increase of miR168 loci amplification in tested samples with increasing concentration of applied elicitor, compared with the control (Fig. 4 LC). The level of response in roots was more sensitive than in leaves.  By comparing the profiles of individual lines of electrophoreograms it can be observed the polymorphism not only in the number of amplified miRNA fragments but also, more importantly, the variability in the amount of amplify DNA represented by the height of individual peaks. 

 

Figure 4. LC. Number of amplified miRNA 168 loci in roots and leaves of control and influenced samples of wheat

 

Observed polymorphism may indicate sequence changes in the miRNA loci, which may result in modification of regulation pattern of targeted sequences [22]. Both in leaf and roots samples, the behaviour of pattern profile of control and two tested variants (0.01% an 0.001% concentration) is similar, while higher concentrations of fungicide have induced changes in fragments quantity and quality in regard to the amount of amplified DNA. The concentration of elicitors, and the incubation time required for maximum elicitation differ with the kind of elicitor [9]. In accordance with the cited works, our results confirmed the role of miR168 as a functional biomarker sensitive to exogenously applied elicitors.

Conclusion

Each methods demonstrates different aspects of DNA polymorphism, however simultaneous application of these approaches can present the impact of plant DNA-derived  elicitor on changes at the molecular level. The application of elicitors in crop protection is not so widespread and most of the experiences come from experimental trials. And such analyzes can contribute to increasing confidence in the use of such formulations, which provide a number of benefits not only for the plant itself but for the surrounding environment.

 

References:

  1. Nazarova L.N., Fochenkova T.V., Korneva L.G. Diseases of winter rust// Protection of plants. 1992. No. 5. p. 52-53.
  2. Tainskiy V. I., Peculiarities of harmfulness of corn loose, root putrid and brown rust of spring wheat/ Naumova I. P., Gaponova A. G., Bey-Bienko N. G.// Agricultural biology. 2002. No. 3. p. 104-108.
  3. Levitin M. M., Tyuterev S. L., Fungus diseases of corn culture// Protection and quarantine of plants. 2003. No. 11.
  4. Ryjkin D. V., Kevkina L. M., Rust fungus of the North-East of the Republic of Mordovia // Mycology and phyto therapy. Volume 38. 2004. No. 4. p. 45-50.
  5. Karnauhova T. B., Shkalikov V. A., Phyto sanitary and physiological condition of wheat when using different protective means of the nature// Izvestiya TSHA. 2004. No. 3. p. 78-85.
  6. Marchenko O., Implementation of morphogenetic potential of plant organisms// Achievements of modern biology. 1996. Volume 116. No. 3. p. 306-317.
  7. Kulaeva O. N., How the life of plants is regulated// Sorovskiy educational journal. No. 1. 1995. p. 20 – 27.
  8. Dyakov Y. T., 50 years of the theory “gene to gene”// Achievements of modern biology. 1996. Volume 116. No. 3. p. 293-305.
  9. Shakirova F. M., Sahabutdinoba A. R., Signal regulation of plant sustainability to pathogens// Achievement of modern biology. 2003. Vol. 123. No. 6. p. 563-572.
  10. Rojkova N. A., Gerashenkov G. A., Babosha A. V., Action of arachidonic acid and virus infection on phytomagglutinine activeness when forming induced sustainability in tobacco// Physiology of the plant. 2003. Volume 50. No. 5. p. 738-743.
  11. Averyanov A., Active oxygen forms and immune of plants// Achievements of modern biology. 1991. Volume 111. No. 5. p. 722-737
  12. Kretovich V. L., Biochemistry of plants. — Moscow: High School. 1980. p. 445
  13. Ismailova K., Ablakulova N., Kushiev Kh. Fungitoxic And Growth-Promoting Propoties Of The Complexs Copper Component And Glycyrrhizin Acid // European science review. 2016 № 5-6. Pp.3-6
  14. Andreev L. N., Plotnikova Y. M., Wheat rust: cytology and physiology – Moscow: Science. 1989. p. 304
  15. Polyakov Y., Persov M. P., Smirnov V. A., Prediction of vermin and diseases of agricultural plants/– Leningrad: Ear. 1984. p. 318
  16. Murashige T., Skoog F. 1962. A revised medium for rapid growth and bioassays with tabacco tissue cultures. Physiologia Plantarum, 15: 473-497.
  17. Masel H. Usage of tolerance of plants through changing their vulnerability//Contest with plants’ diseases: sustainability and perceptiveness/ Translation from English by Levkina L. M., Pl otnikova Y. M.; Under edition of Y. T. Dyakov – Moscow: Ear. 1984. p. 293
  18. Gorlenko M. V., Brief course of plants’ immune to infectious diseases. Publishing 3rd . – Moscow: High School. 1973. p. 366
  19. Kabata-Pendias, Pendias H. Microelements in soil and plants: translated from English – Moscow: Mir. 1989. p. 439
  20. Talieva M. N., and others, Immune-chemical action of epyn on sustainability of plants to fungus infection/ Talieva M. N., Runkova L. V., Alexandrova V. S., Vasilenko Y. S., Olehnovich L. S. // IV International conference on Growth regulators and development of plants in biotechnologies. (June 26-28, 2001) – Moscow. 2001. p. 126.
  21. Bej S., Basak J. 2014. MicroRNAs: The Potential Biomarkers in Plant Stress Response. American Journal of Plant Sciences, 5: 748-759. 21(8): 805-811.
  22. Kruszka K., Pieczynski M., Windels D., Bielewicz D., Jarmolowski A., Szweykowska-Kulinska Z., Vazquez F. 2012. Role of microRNAs and other sRNAs of plants in their changing environments. Journal of Plant Physiology, 169(2012): 1664-1672.
Информация об авторах

Doctor of Philosophy Gulistan State University, Republic of Uzbekistan, Gulistan

(PhD) биол. наук Гулистанского государственного университета, Республика Узбекистан, г. Гулистан

Master student, Gulistan State University, Republic of Uzbekistan, Gulistan

магистрант Гулистанского государственного университета, Республика Узбекистан, г. Гулистан

ISSN 2311-5459. Метаданные статей журнала размещаются на платформе eLIBRARY.RU.
Св-во о регистрации СМИ: ЭЛ №ФС77-55878 от 17.06.2013
Учредитель журнала: ООО «МЦНО»
Главный редактор - Ларионов Максим Викторович.
Top