ОПРЕДЕЛЕНИЕ ВИРУСНОГО ГЕПАТИТА С МЕТОДОМ ПЦР С ПОМОЩЬЮ ГИБРИДИЗАЦИОННО-ФЛУОРЕСЦЕНТНОЙ ДЕТЕКЦИИ

DETERMINATION OF VIRAL HEPATITIS С WITH PCR METHOD USING HYBRIDIZATION-FLUORESCENT DETECTION
Цитировать:
ОПРЕДЕЛЕНИЕ ВИРУСНОГО ГЕПАТИТА С МЕТОДОМ ПЦР С ПОМОЩЬЮ ГИБРИДИЗАЦИОННО-ФЛУОРЕСЦЕНТНОЙ ДЕТЕКЦИИ // Universum: химия и биология : электрон. научн. журн. Икрамов С.А. [и др.]. 2022. 11(101). URL: https://7universum.com/ru/nature/archive/item/14463 (дата обращения: 27.05.2024).
Прочитать статью:
DOI - 10.32743/UniChem.2022.101.11.14463

 

АННОТАЦИЯ

Целью данного исследования было разработка ПЦР диагностикума в режиме реального времени  для определения вируса гепатита С (ВГС) в плазме крови человека. На основе анализа нуклеотидных последовательностей 6 генотипов ВГС, были сконструированы и синтезированы олигонуклеотидные праймеры и флуоресцентный зонд. Были подобраны условия проведения ПЦР анализа в режиме реального времени. Определенны чувствительность и специфичность диагностикума.

ABSTRACT

The aim of this study was to develop a real-time PCR diagnostic kit for the detection of hepatitis C virus (HCV) in human plasma. Based on the analysis of the nucleotide sequences of 6 HCV genotypes, oligonucleotide primers and a fluorescent probe were designed and synthesized. The conditions for real-time PCR analysis were selected. The sensitivity and specificity of the diagnosticum are determined.

 

Ключевые слова: Вирусный гепатит С, олигонуклеотидные праймеры, ПЦР диагностика, флуоресцентные зонды.

Keywords: Viral hepatitis C, oligonucleotide primers, PCR diagnostics, fluorescent probes.

 

Введение

Гепатит С — это инфекция, вызываемая вирусом гепатита С (ВГС) поражающего клетки печени. Гепатит С передается через контакт с кровью инфицированного человека. Сегодня большинство людей заражаются вирусом гепатита С, пользуясь общими иглами или другим оборудованием, используемым для приготовления и введения наркотиков или др. Для более чем половины людей, инфицированных вирусом гепатита С, он становится длительной хронической инфекцией. Хронический гепатит С может привести к серьезным, даже опасным для жизни проблемам со здоровьем, таким как цирроз и рак печени. Люди с хроническим гепатитом С часто могут не иметь симптомов. Когда появляются симптомы, они часто являются признаком прогрессирующего заболевания печени. Вакцины против гепатита С не существует. Лучший способ предотвратить гепатит С — избегать поведения, которое может привести к распространению болезни, особенно употребления инъекционных наркотиков. Важно пройти тестирование на гепатит С, потому что лечение может вылечить большинство людей с гепатитом С привести к ремиссии заболевания. [1-5].

Геном вируса гепатита С состоит из одноцепочечной РНК с положительной цепью. Он классифицируется в семейство Flaviviridae. Flaviviridae включает 4 рода: Flavivirus, Pestvirus, Hepacivirus и неклассифицируемые вирусы. Кроме HCV, семейство Flaviviridae включает вирус желтой лихорадки, вирус клещевого энцефалита, вирус японского энцефалита, вирус хронической лихорадки. HCV вместе с вирусами HGV/GBV – A, B и HGV/GBV – C являются единственными представителями рода Hepacivirus. Цепочка ВГС демонстрирует большую степень генетической гетерогенности[6-9].

Материалы и методы

Синтез праймеров. Синтез праймеров проводили на ДНК-синтезаторе ASM 2000. Синтез проводился фосфор-амидитным методом на твердофазном полимере. Для этого использовали 4 разных фосфор-амидитных нуклеотида (2-деоксиаденин-5-трифосфат, 2-деокситимидин-5-трифосфат, 2-деоксигуанозин-5-трифосфат, 2-деоксицитидин-5-трифосфат,). После синтеза праймеры растворяются в нужном количестве деионизованной воды (50 мкл) и определяют их концентрацию на спектрофотометре при длине волны 260 нм. Последовательность синтезированных праймеров указаны в Таб.1

Клинические образцы. Для исследования были отобраны 50 образцов плазмы крови человека, из них 40 образцов ВГС позитивных и 10 образцов ВГС негативных, данные образцы были заранее проанализированы на присутствие РНК ВГС с помощью диагностикума «АмплиСенс-HCV-FL» Россия.

Экстракция вирусного РНК (Рибонуклеиновая кислота). Образцы плазмы хранились при -80 C0 до использования. Для экстракция использовали 100 мкл плазмы и набор для экстракции нуклеиновых кислот органическими растворителями ЭНКОР (ИХРВ, Узбекистан). Выделенные образцы РНК ВГС использовали сразу же для постановки ПЦР анализа.

Постановка стандартного ПЦР. В пробирки вносят по 10 мкл раствора исследуемой РНК (Рибонуклеиновая кислота выделенная из образцов человека), 1 мкл реверс и форвард праймеров, 1 мкл смеси нуклеотидов DNTPs ( смесь растворов дезоксинуклеотидов А,Т,G,C ) , 5,6 мкл H2O, 1 мкл 12,5 мМ MgCl2, 4 мкл ПЦР буфера( состав буфера  указан в таб-1), 1 мкл ингибитора РНКаз (кофакторы ингибирующий РНКазы),1 мкл фермента ММLV OT 25 ед.на мкл (фермент обратной транскрипции), 0,2 мкл фермента Taq полимеразы 2,5 ед. на мкл(фермент ДНК полимеразы). Содержимое пробирок вортексируется. После помещают пробирки в ПЦР установку Robocycler gradient 96 фирмы STRATAGENE и проводят ПЦР по программе:

500С – 15 мин 1 цикл

950С – 05 мин 1 цикл

950С – 10 сек

600С – 40 сек 40 циклов

Определение ВГС используя RT OT – ПЦР.  Для этого приготавливали реакционную смесь состоящую из 10 мкл раствора РНК , 1 мкл реверс праймера, 1 мкл форвард праймера, 0,1 мкл зонда, 1 мкл смеси нуклеотидов DNTPs (раствор нуклеотидов А,Т,G,C), 5,6 мкл H2O, 1 мкл MgCl2, 4 мкл буфера, 1 мкл ингибитора РНКаз (фермент ингибирующий РНКазы),1 мкл фермента ММLV OT (фермент обратной транскрипции), 0,2 мкл фермента Taq полимеразы (фермент полимеразаной реакции), и тщательно перемешали реактивы. Анализ провели используя прибор  Applied Biosystems Quant studio 5 по следующей программе:

Таблица 1.

Программа амплификации

Этап

Температура, °С

Время

Измерение флуоресценции

Количество циклов

1

50

15 минут

-

1

2

95

5 минут

-

1

3

95

10 секунд

-

 

5

60

20 секунд

-

72

15 секунд

-

4

95

10секунд

-

40

60

20 секунд

FAM/Green, JOE/Yellow

72

15 секунд

-

 

Специфичность. Для определения диагностической специфичности, были использованы   образцы плазмы крови  здоровых людей и образцы плазмы крови ВИЧ и ВГБ положительных больных. Для определения клинической специфичности, были взяты 10 отрицательных ВГС образца , 3 ВИЧ положительных образца и 3 ВГБ положительных образца. Эти образцы были заранее протестированы и подтвержденны на ВГС отрицательность используя серологические и молекулярные методы.

Результаты и их обсуждение

В этом исследовании была произведена разработка определения ВГС при помощи метода ПЦР в режиме реального времени используя обратную транскрипцию. Для этого были проанализированы последовательности шести основных генотипов ВГС для нахождения общих консервативных участков для всех генотипов. Для этого Мы использовали последовательности геномов 6 генотипов ВГС из баз данных NCBI. При помощи программы DNA LASERGENE был найден наиболее консервативный участок для всех генотипов ВГС. Этот участок расположен в 5-NC некодирующем регионе генома ВГС длинной 344 п.н. ( Рис.1.) .

 

Рисунок 1. Последовательность нуклеотидов 5´-NC – некодирующего региона

 

На этот консервативный участок были сконструированы 3 пары олигонуклеотидных праймеров Таблица 1. Термодинамические свойства сконструированных праймеров были проверенны путем использования программы Oligo Analyze.

Таблица 1.

Термодинамические свойства сконструированных праймеров

Условное название

праймеров

Нуклеотидная последовательность

Длина

праймера

1

ACF91

CGGAACCGGTGAGTACACCGGAAT

24

2

ACR93

GGCCGTGCAGTGGCGCGCACACCCAA

26

3

HCV94-F

CCTCTAGCCATGGCGTTAGTA

21

4

HCV95-R

CAAGCACCCTATCAGGCAGTA

21

5

HC1313

CATGGCGTTAGTATGAGTGTCG

22

6

HC1314

TCCGCAGACCACTATGGCTC

20

7

Zond

ТЕТ-CGGGAGAGCCATAGTGGTCTGCG-BHQ2

23

 

Затем эти праймеры были синтезированы на автоматическом синтезатора ASM-2000 фосфороамидитным методом. Для нахождения оптимальных условий проведения ПЦР и эффективности полученных олигонуклеотидных праймеров провели эксперимент. Эксперимент состоял в определении наиболее эффективной пары праймеров. Результаты ПЦР определили проведением агарозного электрофореза Рис.2.

 

Рисунок 2. Электрофорез 2% агарозном геле продуктов ПЦР
1 -ACF91/ACR93; 2- HCV94-F/HCV95-R; 3- HC1313/HC1314;4- ACF91/ACR93; 5- HCV94-F/HCV95-R; 6- HC1313/HC1314 – пар олигонуклеотидных праймеров

 

По итогам электрофореза установлено что праймеры форвард HCV94-F, реверс HCV95-R, показала самый большой выход ампликона, и для дальнейших исследований была выбрана именно эта пара праймеров. Для проведения ПЦР в режиме реального времени для этих пар праймеров был сконструирован флуоресцентный зонд Таб.1.

С выбранными олигонуклеотидными праймерами HCV94-F/HCV95-R и синтезированным флуоресцентным зондом Zond был проведен ПЦР анализ в режиме реального времени используя обратную транскрипцию. Результаты ПЦР анализа предоставленны в графике амплификации Рис.3. Все 4 ВГС положительных образцов показали подъем в графике амплификации, максимальный рост флуоресцентного сиганала составил 110 000 , минимальный 63 000 . Таким образом пара праймеров  HCV94-F/HCV95-R и флуоресцентный зонд показали свою эффективность в определении РНК  ВГС выделенного из образцов крови плазмы человека.

 

Рисунок 3. График амплификации RT -OT ПЦР в определении ВГС
Образцы показали рост флуоресцентного сигнала 1-110000, 2- 92000, 3- 74000, 4- 63000

 

Для определения чувствительности разработанного RT- ПЦР диагностикума, были определенны различные концентрации РНК ВГС. Для этого использовали образцы плазмы с заранее известной вирусной нагрузкой ВГС, и разведенные физ.раствором для получения  106, 105, 104, 103,102  частиц на 1 мл плазмы.

 

Рисунок 4. Чувствительность ПЦР анализа при определении РНК ВГС в образцах разных концентраций: 1-106 копий, 2-105 копий, 3-104 копий, 4-103 – копий, 5-102- копий

 

В результате анализа самое минимальное количество РНК ВГС которое может определить наша система равняется 100 копий вируса на мл (Рис.4). Это свидетельствует что чувствительность этой системы высокое.

Для определения специфичность диагностикума был проведен следующий эксперимент. Исследовались 8 образцов ВГС положительных, 3 отрицательных образца здоровых людей, 3 образца с положительных к вирусу гепатита Б (ВГБ) и 3 образца положительных к ВИЧ.

 

Рисунок 5. График амплификации на специфичность анализа ПЦР при определении РНК ВГС. Зеленый – положительные образцы ВГС, синий – положительные образцы ВГБ и ВИЧ, , красный – отрицательные образцы

 

Как видно из графика амплификации (Рис.5) положительные образцы ВГС ( кривые зеленого цвета) показывают повышение флуоресцентного сигнала, и при этом положительные образцы на ВГБ и ВИЧ ( кривые синего цвета) не вызывают увеличение значения флуоресцентного сигнала, что свидетельствует об отсутствии перекрестных реакций с другими инфекциями. Согласно полученным данным разработанный диагностикум показывает 100 % специфичность. 

Таким образом анализированы нуклеотидные последовательности шести генотипов вирусного гепатита С на основе баз данных NCBI, благодаря анализу идентифицирован генетический участок, пригодный для синтеза праймеров: 5I - NC - некодирующая область. Осуществлен дизайн и синтез праймеров для амплификации фрагментов ДНК методом ПЦР. Разработана методика проведения RT-ОТ- ПЦР в режиме реального времени . Определенны чувствительность и специфичность диагностической системы равные 100 копий/мл, 100 % соответственно.

 

Список литературы:

  1. (Гепатит C. Всемирная организация здравоохранения, Информационный бюллетень , 24 июнь 2022).
  2. Lavanchy D: The global burden of hepatitis C. Liver Int 2009, 29(Suppl 1):74–81.
  3. Butt AA: Hepatitis C virus infection: the new global epidemic. Expert Rev.2015
  4. L.Krekulova, V.Rehak, L.W.Riley : Structure and functions of Hepatitis C Virus proteins: 15 years after. Folia Microbiol.51(6), 665-680 (2006).
  5. Kim WR: The burden of hepatitis C in the United States. Hepatology 2002 36:S30–S34
  6. Simmonds P.: Viral heterogeneity of the hepatitis C virus. J.Gen.Virol. 82, 693–712 (2001).
  7. Lindenbach BD, Rice SM (2001). Flaviviridae: Viruses and their replication, in the field of virology. (Philadelphia: Lippincot - Raven), pp. 991-1042.
  8. Kato N., Hijikata M.: Molecular cloning of the human hepatitis C virus genom from Japanese patients with non – A, non-B hepatitis. Proc.Nat.Acad.Sci.USA 87. 9524-9528 (1990).
  9. Chevaliez S.,  Pawlotsky J.M.: HCV genome and life cycle. Horizon Bioscience, chapter -1,2006, 1-5.
Информация об авторах

мл. науч. сотр, лаборатория молекулярной генетики, Институт химии растительных веществ им. акад. С.Ю. Юнусова АН РУз., Республика Узбекистан, г. Ташкент

Junior researcher, laboratory of molecular genetics Institute of Chemistry of Plant Substances Academy of Sciences, Republic of Uzbekistan, Tashkent

мл. науч. сотр, лаборатория молекулярной генетики, Институт химии растительных веществ им. акад. С.Ю. Юнусова АН РУз., Республика Узбекистан, г. Ташкент

Junior researcher, laboratory of molecular genetics Institute of Chemistry of Plant Substances Academy of Sciences, Republic of Uzbekistan, Tashkent

мл. науч. сотр, лаборатория молекулярной генетики, Институт химии растительных веществ им. акад. С.Ю. Юнусова АН РУз., Республика Узбекистан, г. Ташкент

Junior researcher, laboratory of molecular genetics Institute of Chemistry of Plant Substances Academy of Sciences, Republic of Uzbekistan, Tashkent

мл. науч. сотр, лаборатория молекулярной генетики, Институт химии растительных веществ им. акад. С.Ю. Юнусова АН РУз., Республика Узбекистан, г. Ташкент

Junior researcher, laboratory of molecular genetics Institute of Chemistry of Plant Substances Academy of Sciences, Republic of Uzbekistan, Tashkent

мл. науч. сотр, лаборатория молекулярной генетики, Институт химии растительных веществ им. акад. С.Ю. Юнусова АН РУз., Республика Узбекистан, г. Ташкент

Junior researcher, laboratory of molecular genetics Institute of Chemistry of Plant Substances Academy of Sciences, Republic of Uzbekistan, Tashkent

мл. науч. сотр, лаборатория молекулярной генетики, Институт химии растительных веществ им. акад. С.Ю. Юнусова АН РУз., Республика Узбекистан, г. Ташкент

Junior researcher, laboratory of molecular genetics Institute of Chemistry of Plant Substances Academy of Sciences, Republic of Uzbekistan, Tashkent

д-р биол. наук, проф., зав. лаб. молекулярной генетики, Институт химии растительных веществ им. акад. С.Ю. Юнусова АН РУз., Республика Узбекистан, г. Ташкент

Doctor of Biological Sciences, Professor Head of laboratory of molecular genetics Institute of Chemistry of Plant Substances, Academy of Sciences, Republic of Uzbekistan, Tashkent

Журнал зарегистрирован Федеральной службой по надзору в сфере связи, информационных технологий и массовых коммуникаций (Роскомнадзор), регистрационный номер ЭЛ №ФС77-55878 от 17.06.2013
Учредитель журнала - ООО «МЦНО»
Главный редактор - Ларионов Максим Викторович.
Top